non targeting scrambled shrna control (OriGene)
OriGene is a verified supplier 
OriGene manufactures this product 
96
Structured Review
OriGene
non targeting scrambled shrna control
Non Targeting Scrambled Shrna Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 205 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+tr30021/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm41857410-324-41-45
Average 96 stars, based on 205 article reviews
Non Targeting Scrambled Shrna Control, supplied by OriGene, used in various techniques. Bioz Stars score: 96/100, based on 205 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/control+shrna+tr30021/Scrambled+shRNA+control+in+pGFP-C-shLenti+shRNA+Vector/pm41857410-324-41-45
Average 96 stars, based on 205 article reviews
non targeting scrambled shrna control - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: Targeting the MLL complex in castration-resistant prostate cancer. Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191 and RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from Thermo Scientific. shRNA targeting MEN1 (TRCN0000338331 and TRCN0000040141) and control shRNA (SHC202) were from Sigma. shRNA targeting KMT2A (TL311462) and KMT2B (TL315696) and Article Title: Targeting the MLL complex in castration resistant prostate cancer Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191, RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from OpenBiosystems/Dharmacon. shRNA targeting menin (TRCN0000338331, and TRCN0000040141) and control shRNA were from Sigma. shRNA targeting MLL (TL311462) and MLL4 (TL315696) and shRNA:Article Title: Targeting the MLL complex in castration-resistant prostate cancer. Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191 and RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from Thermo Scientific. shRNA targeting MEN1 (TRCN0000338331 and TRCN0000040141) and control shRNA (SHC202) were from Sigma. shRNA targeting KMT2A (TL311462) and KMT2B (TL315696) and Article Title: Proteolytic Activation of the Protease-activated Receptor (PAR)-2 by the Glycosylphosphatidylinositol-anchored Serine Protease Testisin Article Snippet: .. Generation of Testisin shRNA Knockdown Cell Lines Three testisin-specific shRNAs TL310139C (shRNA 1), TL310139D (shRNA 2), and TL310139A (shRNA 3) or scrambled negative Article Title: Targeting the MLL complex in castration resistant prostate cancer Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191, RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from OpenBiosystems/Dharmacon. shRNA targeting menin (TRCN0000338331, and TRCN0000040141) and control shRNA were from Sigma. shRNA targeting MLL (TL311462) and MLL4 (TL315696) and Article Title: Pharmacological Inhibition of Insulin Growth Factor-1 Receptor (IGF-1R) Alone or in Combination With Ruxolitinib Shows Therapeutic Efficacy in Preclinical Myeloproliferative Neoplasm Models Article Snippet: .. A total of 2 mL of cells were infected with lentiviral particles expressing a short hairpin ribonucleic acid (shRNA) targeting murine insulin like growth factor-1-receptor (mIGF-1R) (TL320384, Origene Technologies, Rockville, MD, USA, sequence GAAGATCCGCCATTCTCATGCCTTGGTCT) or a Article Title: ETS1 Suppresses Tumorigenesis of Human Breast Cancer via Trans-Activation of Canonical Tumor Suppressor Genes Article Snippet: The following chemicals were used; phorbol 12-myristate 13-acetate (PMA, Calbiochem: 524400) and Ionomycin (Calbiochem: 407950). .. Gene knockdown was accomplished using the shRNA system with Article Title: Proteolytic Activation of the Protease-activated Receptor (PAR)-2 by the Glycosylphosphatidylinositol-anchored Serine Protease Testisin Article Snippet: .. Three testisin-specific shRNAs TL310139C (shRNA 1), TL310139D (shRNA 2), and TL310139A (shRNA 3) or scrambled negative Control:Article Title: Targeting the MLL complex in castration-resistant prostate cancer. Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191 and RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from Thermo Scientific. shRNA targeting MEN1 (TRCN0000338331 and TRCN0000040141) and control shRNA (SHC202) were from Sigma. shRNA targeting KMT2A (TL311462) and KMT2B (TL315696) and Article Title: Targeting the MLL complex in castration resistant prostate cancer Article Snippet: .. Lentiviral plasmid encoding shRNA targeting ASH2L (RHS4430-98851191, RHS4430-99881709) or control shRNA (GIPZ, RHS4346) were from OpenBiosystems/Dharmacon. shRNA targeting menin (TRCN0000338331, and TRCN0000040141) and control shRNA were from Sigma. shRNA targeting MLL (TL311462) and MLL4 (TL315696) and Article Title: Pharmacological Inhibition of Insulin Growth Factor-1 Receptor (IGF-1R) Alone or in Combination With Ruxolitinib Shows Therapeutic Efficacy in Preclinical Myeloproliferative Neoplasm Models Article Snippet: .. A total of 2 mL of cells were infected with lentiviral particles expressing a short hairpin ribonucleic acid (shRNA) targeting murine insulin like growth factor-1-receptor (mIGF-1R) (TL320384, Origene Technologies, Rockville, MD, USA, sequence GAAGATCCGCCATTCTCATGCCTTGGTCT) or a Article Title: ETS1 Suppresses Tumorigenesis of Human Breast Cancer via Trans-Activation of Canonical Tumor Suppressor Genes Article Snippet: The following chemicals were used; phorbol 12-myristate 13-acetate (PMA, Calbiochem: 524400) and Ionomycin (Calbiochem: 407950). .. Gene knockdown was accomplished using the shRNA system with Knockdown:Article Title: Proteolytic Activation of the Protease-activated Receptor (PAR)-2 by the Glycosylphosphatidylinositol-anchored Serine Protease Testisin Article Snippet: .. Generation of Testisin shRNA Knockdown Cell Lines Three testisin-specific shRNAs TL310139C (shRNA 1), TL310139D (shRNA 2), and TL310139A (shRNA 3) or scrambled negative Article Title: ETS1 Suppresses Tumorigenesis of Human Breast Cancer via Trans-Activation of Canonical Tumor Suppressor Genes Article Snippet: The following chemicals were used; phorbol 12-myristate 13-acetate (PMA, Calbiochem: 524400) and Ionomycin (Calbiochem: 407950). .. Gene knockdown was accomplished using the shRNA system with Negative Control:Article Title: Proteolytic Activation of the Protease-activated Receptor (PAR)-2 by the Glycosylphosphatidylinositol-anchored Serine Protease Testisin Article Snippet: .. Generation of Testisin shRNA Knockdown Cell Lines Three testisin-specific shRNAs TL310139C (shRNA 1), TL310139D (shRNA 2), and TL310139A (shRNA 3) or scrambled negative Article Title: Proteolytic Activation of the Protease-activated Receptor (PAR)-2 by the Glycosylphosphatidylinositol-anchored Serine Protease Testisin Article Snippet: .. Three testisin-specific shRNAs TL310139C (shRNA 1), TL310139D (shRNA 2), and TL310139A (shRNA 3) or scrambled negative Infection:Article Title: Pharmacological Inhibition of Insulin Growth Factor-1 Receptor (IGF-1R) Alone or in Combination With Ruxolitinib Shows Therapeutic Efficacy in Preclinical Myeloproliferative Neoplasm Models Article Snippet: .. A total of 2 mL of cells were infected with lentiviral particles expressing a short hairpin ribonucleic acid (shRNA) targeting murine insulin like growth factor-1-receptor (mIGF-1R) (TL320384, Origene Technologies, Rockville, MD, USA, sequence GAAGATCCGCCATTCTCATGCCTTGGTCT) or a Expressing:Article Title: Pharmacological Inhibition of Insulin Growth Factor-1 Receptor (IGF-1R) Alone or in Combination With Ruxolitinib Shows Therapeutic Efficacy in Preclinical Myeloproliferative Neoplasm Models Article Snippet: .. A total of 2 mL of cells were infected with lentiviral particles expressing a short hairpin ribonucleic acid (shRNA) targeting murine insulin like growth factor-1-receptor (mIGF-1R) (TL320384, Origene Technologies, Rockville, MD, USA, sequence GAAGATCCGCCATTCTCATGCCTTGGTCT) or a Sequencing:Article Title: Pharmacological Inhibition of Insulin Growth Factor-1 Receptor (IGF-1R) Alone or in Combination With Ruxolitinib Shows Therapeutic Efficacy in Preclinical Myeloproliferative Neoplasm Models Article Snippet: .. A total of 2 mL of cells were infected with lentiviral particles expressing a short hairpin ribonucleic acid (shRNA) targeting murine insulin like growth factor-1-receptor (mIGF-1R) (TL320384, Origene Technologies, Rockville, MD, USA, sequence GAAGATCCGCCATTCTCATGCCTTGGTCT) or a |